View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10373_high_14 (Length: 237)
Name: NF10373_high_14
Description: NF10373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10373_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 23 - 224
Target Start/End: Original strand, 35856187 - 35856388
Alignment:
| Q |
23 |
ggcagttgcttaaccacataaagtctatccgtgacaaggaaatagatgtaggaataattaatccagcagatatattcaagttcggaggcacaaaatatta |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35856187 |
ggcagttgcttaaccacataaagtctatccgtgacaaggaaatagatgtaggaataattaatccagcagatatattcaagttcggaggcacaaaatatta |
35856286 |
T |
 |
| Q |
123 |
cagatatattggttctcttacaagtccaccatgcactgaagatgttatttggacagttttgaagaaggtatatactttaattttcatgtgattctcttaa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35856287 |
cagatatattggttctcttacaagtccaccatgtactgaagatgttatttggacagttttgaagaaggtatatactttaattttcatgtgattctcttaa |
35856386 |
T |
 |
| Q |
223 |
ct |
224 |
Q |
| |
|
|| |
|
|
| T |
35856387 |
ct |
35856388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University