View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10373_high_7 (Length: 273)
Name: NF10373_high_7
Description: NF10373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10373_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 863526 - 863309
Alignment:
| Q |
1 |
cttatgcaaagttagcctctctcttgctccttccaattctttcaagtgaccattctttggatcatctaattatatnnnnnnnnnnnnnnnnttcacacat |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
863526 |
cttatgcaaagttaacctctctcttgctccttccaattcttttaagtgaccattctttggatcctctaattatataaaaataaaacaaaaattcacacat |
863427 |
T |
 |
| Q |
101 |
caatactcaagtcagaaataatataaatttcaact-aaacatgaaattaataaagcgaccaatttatttatttaacttaacatgcaagaaatagatatta |
199 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
863426 |
caatactcaagtcagaaataacataaatttcaacttaaacatgaaattaataaaactagcaatttatttatttaacttaacatgcaagaaatagatatta |
863327 |
T |
 |
| Q |
200 |
tgtcatgttatgttatgt |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
863326 |
tgtcatgttatgttatgt |
863309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 221 - 261
Target Start/End: Original strand, 863055 - 863095
Alignment:
| Q |
221 |
cacaaaaacatgcctgcctatgataacacttcatcggtctc |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
863055 |
cacaaaaacatgcctgcctatgataacacttcatcagtctc |
863095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 67
Target Start/End: Complemental strand, 45242068 - 45242008
Alignment:
| Q |
7 |
caaagttagcctctctcttgctccttccaattctttcaagtgaccattctttggatcatct |
67 |
Q |
| |
|
|||||||||||| ||| ||||||||||||| | ||||||||| ||||| |||||||||||| |
|
|
| T |
45242068 |
caaagttagcctttcttttgctccttccaactttttcaagtgcccattttttggatcatct |
45242008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University