View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10373_low_10 (Length: 299)
Name: NF10373_low_10
Description: NF10373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10373_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 43 - 294
Target Start/End: Complemental strand, 44247505 - 44247254
Alignment:
| Q |
43 |
caacctcaatatttagnnnnnnnaaaccttatccaattaaaatggatcctctcatgtaatatgagggttcgacgaaatcctccttgtttcatcatatcgg |
142 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44247505 |
caacctcaatatttagtttttttaaaccttatccaattaaaatggatcctctcatgtaatatgagggttcgacgaaatcctccttgtttcatcatatcgg |
44247406 |
T |
|
| Q |
143 |
agaggnnnnnnnntttagagttaagaatgtggacatatccaattaaaacttagagnnnnnnnattcatcactggacatatcctccattgtttatttttac |
242 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44247405 |
agaggaaaaaaaatttagagttaagaatgtggacatatccaattaaaatttagagtttttttattcatcactggacatatcctccattgtttatttttac |
44247306 |
T |
|
| Q |
243 |
tatatattaattacaatttagtgttaagaatgttttttaaccctttgcttct |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44247305 |
tatatattaattacaatttagtgttaagaatgttttttaaccctttggttct |
44247254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University