View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10373_low_11 (Length: 297)
Name: NF10373_low_11
Description: NF10373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10373_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 20 - 228
Target Start/End: Original strand, 29098537 - 29098751
Alignment:
| Q |
20 |
tgcctcaaaatcaatggggtggccttgatatta---catggtcagatgcttgatgttgctgaagttgggaatttaatttctggttttgtttctata-ttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
29098537 |
tgcctcaaaatcaatggggtggccttgatatcatcacatggtcagatgcttgatgttgctgaagttgggaattttatttctggttttgtttctatatttg |
29098636 |
T |
 |
| Q |
116 |
taattagttcatttttgcgaacnnnnnnnctctctttagtgtttcatgtgtatgtcgttctattgtaaaattatgaac---ttttatacatactattttc |
212 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29098637 |
taattagttca-ttttgcgaactttttttctctctttagtgtttcatgtgtatatcgttctattgtaaaattatgaactttttttatacatactattttc |
29098735 |
T |
 |
| Q |
213 |
acacgtatatatcaaa |
228 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
29098736 |
acacgtatacatcaaa |
29098751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 15 - 70
Target Start/End: Complemental strand, 3617443 - 3617388
Alignment:
| Q |
15 |
gggtgtgcctcaaaatcaatggggtggccttgatattacatggtcagatgcttgat |
70 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3617443 |
gggtgtgcctcaagatcaatggggtggcctagatattacatggtcagatgcttgat |
3617388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 15 - 70
Target Start/End: Complemental strand, 29058136 - 29058081
Alignment:
| Q |
15 |
gggtgtgcctcaaaatcaatggggtggccttgatattacatggtcagatgcttgat |
70 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29058136 |
gggtgtgcctcaagatcaatggggtggccttgacattacatggtcagatgcttgat |
29058081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 15 - 70
Target Start/End: Complemental strand, 29071364 - 29071309
Alignment:
| Q |
15 |
gggtgtgcctcaaaatcaatggggtggccttgatattacatggtcagatgcttgat |
70 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29071364 |
gggtgtgcctcaagatcaatggggtggccttgacattacatggtcagatgcttgat |
29071309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 16 - 70
Target Start/End: Original strand, 28957011 - 28957065
Alignment:
| Q |
16 |
ggtgtgcctcaaaatcaatggggtggccttgatattacatggtcagatgcttgat |
70 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28957011 |
ggtgtgcctcaagatcaatggggtggccttgacattacatggtcagatgcttgat |
28957065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 219 - 283
Target Start/End: Original strand, 29098920 - 29098984
Alignment:
| Q |
219 |
atatatcaaatcctaaactaactatttccctcgttcaaacccnnnnnnnatagaccataaatatt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29098920 |
atatatcaaatcctaaactaactatttccctcgttcaaaccctttttttatagaccataaatatt |
29098984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 16 - 70
Target Start/End: Complemental strand, 29110847 - 29110793
Alignment:
| Q |
16 |
ggtgtgcctcaaaatcaatggggtggccttgatattacatggtcagatgcttgat |
70 |
Q |
| |
|
||||||||| || | ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29110847 |
ggtgtgcctaaagaacaatggggtggtcttgatattacatggtcagatgcttgat |
29110793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 29078096 - 29078043
Alignment:
| Q |
16 |
ggtgtgcctcaaaatcaatggggtggccttgatattacatggtcagatgcttga |
69 |
Q |
| |
|
||||||||| || | ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29078096 |
ggtgtgcctaaagaacaatggggtggccttgacattacatggtcagatgcttga |
29078043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 29068899 - 29068847
Alignment:
| Q |
18 |
tgtgcctcaaaatcaatggggtggccttgatattacatggtcagatgcttgat |
70 |
Q |
| |
|
||||||| || | ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29068899 |
tgtgcctaaagagcaatggggtggccttgacattacatggtcagatgcttgat |
29068847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 15 - 70
Target Start/End: Original strand, 11851808 - 11851863
Alignment:
| Q |
15 |
gggtgtgcctcaaaatcaatggggtggccttgatattacatggtcagatgcttgat |
70 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11851808 |
gggtgtgcctcaagatcaatggggtggccttgacattacatggtcagatgcttgat |
11851863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 11854525 - 11854577
Alignment:
| Q |
18 |
tgtgcctcaaaatcaatggggtggccttgatattacatggtcagatgcttgat |
70 |
Q |
| |
|
||||||| || | ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11854525 |
tgtgcctaaagagcaatggggtggccttgacattacatggtcagatgcttgat |
11854577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University