View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10373_low_21 (Length: 231)
Name: NF10373_low_21
Description: NF10373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10373_low_21 |
 |  |
|
| [»] scaffold0288 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0288 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 14 - 70
Target Start/End: Original strand, 17439 - 17495
Alignment:
| Q |
14 |
aaagggaaaaactaaaaagacaaacaacaaattttgaatgacttatccaccaaggta |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17439 |
aaagggaaaaactaaaaagacaaacaacaaattttgaatgacttatccaccaaggta |
17495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 96 - 214
Target Start/End: Original strand, 17492 - 17612
Alignment:
| Q |
96 |
ggtagagaaagaaaattgtgctatctttagttgaatgattcatttaagnnnnnnnngtatagtacatcacaacatctgc--annnnnnnggaccaccggc |
193 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17492 |
ggtagagaaacaaagttgtgctatctttagttgaatgattcatttaagttttttttgtatagtacatcacaacatctgctattttttttggaccaccggc |
17591 |
T |
 |
| Q |
194 |
accaaccttgcagctccaacc |
214 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
17592 |
accaaccttgcagctccaacc |
17612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 34 - 115
Target Start/End: Complemental strand, 3792031 - 3791951
Alignment:
| Q |
34 |
caaacaacaaattttgaatgacttatccaccaaggtaacacgcagcagggaaaaaccaagttggtagagaaagaaaattgtg |
115 |
Q |
| |
|
||||| ||||||||||||||| | |||||| ||||||||| |||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3792031 |
caaaccacaaattttgaatgattcatccac-aaggtaacatgcagaagggaaactccaagttggtagagaaagaaaattgtg |
3791951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University