View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10374_high_5 (Length: 228)
Name: NF10374_high_5
Description: NF10374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10374_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 37379770 - 37379991
Alignment:
| Q |
1 |
cgcggaggctgatggaagaggcgcaccggtggtgctgagagagtttatgaaatcgacgattatggagcgttggattggagtgaatgttccgtaccagatt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37379770 |
cgcggaggctgatggaagagccgcaccggtggtgctgagagagtttatgaaatcgacgattatggagcgttggattggagtgaatgttccgtaccagatt |
37379869 |
T |
 |
| Q |
101 |
agattaacggtgagctttcctttgagaagctggccgttatggtacttgagtacaagaggttgttcctgtacaagctctccaaaggagagtgtaggtagaa |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37379870 |
agattaacggtgagctttcctttaagaagctggccgttatggtacttgagtacaagaggttgttcctgtacaagctctccaaaggagagtgtaggtagaa |
37379969 |
T |
 |
| Q |
201 |
ccagaagcaatactgcagaaag |
222 |
Q |
| |
|
| |||||||||||||||||||| |
|
|
| T |
37379970 |
caagaagcaatactgcagaaag |
37379991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 31 - 113
Target Start/End: Complemental strand, 1760539 - 1760457
Alignment:
| Q |
31 |
ggtgctgagagagtttatgaaatcgacgattatggagcgttggattggagtgaatgttccgtaccagattagattaacggtga |
113 |
Q |
| |
|
|||| |||| ||||||||||| ||||||||||| || |||||||||||| |||| | |||||||| | ||||||||||||| |
|
|
| T |
1760539 |
ggtggtgagtgagtttatgaagtcgacgattattgaacgttggattggattgaagctaccgtaccataagagattaacggtga |
1760457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University