View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10374_low_20 (Length: 202)
Name: NF10374_low_20
Description: NF10374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10374_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 19 - 171
Target Start/End: Original strand, 10457776 - 10457928
Alignment:
| Q |
19 |
agagtgagtgatcgaacagtgaattacctgcaaaaatggagattggatttctgggtttggggataatgggcaaagccatgtcaattaaccttctacgcca |
118 |
Q |
| |
|
|||||||||||| ||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10457776 |
agagtgagtgattaaacagtgaattactttcaaaaatggagattggatttctgggtttgggaataatgggcaaagccatgtcaattaaccttctacgcca |
10457875 |
T |
|
| Q |
119 |
tggtttcaaagtcactgtttggaacagaaccctctccaaggtacccactttct |
171 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10457876 |
tggcttcaaagtcactgtttggaacagaaccctctccaaggtacccactttct |
10457928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 21 - 86
Target Start/End: Complemental strand, 30438412 - 30438346
Alignment:
| Q |
21 |
agtgagtgatcgaacagtgaa-ttacctgcaaaaatggagattggatttctgggtttggggataatg |
86 |
Q |
| |
|
||||| ||||||||||||||| ||| |||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
30438412 |
agtgaatgatcgaacagtgaaattagttgcaaaaatggagattggatttatgggtctggggataatg |
30438346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University