View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10374_low_8 (Length: 389)
Name: NF10374_low_8
Description: NF10374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10374_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 16 - 378
Target Start/End: Original strand, 37170423 - 37170790
Alignment:
| Q |
16 |
cacaaacaccctcacaaccgtcttcctcttaattccgctaggtaaattttccaaaacacg----gtctattttatgaatcaaatgttagttaaaattata |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37170423 |
cacaaacaccctcacaaccgtcttcctcttatttccgctaggtaaattttccaaaacacgtacggtctattttatgaatcaaatgttagttaaaattat- |
37170521 |
T |
|
| Q |
112 |
tatgctgctgatgttatttttgtttatt-----gttactcagattttatgcagctcaagtattggtggcgttggagtaccttcacatgctgggaatcatt |
206 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37170522 |
---gctgctgatgttatttttgtttattatattgttactcagattttatgcagctcaagtattggtggcgttggagtaccttcacatgctgggaatcatt |
37170618 |
T |
|
| Q |
207 |
tacagagatctaaagcctgagaatgtgttagttcgatcagacggtcacattatgctttcagatttcgatctttcactttgctcaaatgcaatcccagctg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37170619 |
tacagagatctaaagcctgagaatgtgttagttcgatcagacggtcacattatgctttcagatttcgatctttcactttgctcaaatgcaatcccagctg |
37170718 |
T |
|
| Q |
307 |
ttgaatcatcagataatttacaagattcttccactttttcatcaacattaccctacactcgttcccgttctt |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37170719 |
ttgaatcatcagataatttacaagattcttccactttttcatcaacattaccctacactcgttcccgttctt |
37170790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 4e-23; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 150 - 317
Target Start/End: Complemental strand, 6073078 - 6072911
Alignment:
| Q |
150 |
ttttatgcagctcaagtattggtggcgttggagtaccttcacatgctgggaatcatttacagagatctaaagcctgagaatgtgttagttcgatcagacg |
249 |
Q |
| |
|
|||||||| ||| ||||| ||||||| |||||||| || |||||| | ||||| || ||||||||| ||||||| || || |||||||| |||| |||| |
|
|
| T |
6073078 |
ttttatgcggctgaagtactggtggcattggagtatctgcacatgttaggaataatctacagagatttaaagccggaaaacgtgttagtcagatcggacg |
6072979 |
T |
|
| Q |
250 |
gtcacattatgctttcagatttcgatctttcactttgctcaaatgcaatcccagctgttgaatcatca |
317 |
Q |
| |
|
||||||| ||||| |||||||| ||||| ||||| || ||||||||||||| |||||||||||| |
|
|
| T |
6072978 |
gtcacatcatgctctcagattttgatctctcactaatttcccatgcaatcccagcggttgaatcatca |
6072911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 183 - 247
Target Start/End: Original strand, 36109415 - 36109479
Alignment:
| Q |
183 |
taccttcacatgctgggaatcatttacagagatctaaagcctgagaatgtgttagttcgatcaga |
247 |
Q |
| |
|
|||||||||||| ||||||| | ||| | ||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
36109415 |
taccttcacatgttgggaatagtataccgtgatctgaagccagagaatgtattagttcgatcaga |
36109479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 180 - 283
Target Start/End: Original strand, 46834632 - 46834735
Alignment:
| Q |
180 |
gagtaccttcacatgctgggaatcatttacagagatctaaagcctgagaatgtgttagttcgatcagacggtcacattatgctttcagatttcgatcttt |
279 |
Q |
| |
|
||||| || |||||| ||||||| | ||||||||| ||||||| |||||||| ||||| || ||| || ||||| |||||||||||||| ||||||| |
|
|
| T |
46834632 |
gagtatctacacatgatgggaatagtatacagagatttaaagccagagaatgttttagtaagagaagatggacacataatgctttcagattttgatcttt |
46834731 |
T |
|
| Q |
280 |
cact |
283 |
Q |
| |
|
|||| |
|
|
| T |
46834732 |
cact |
46834735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 177 - 277
Target Start/End: Complemental strand, 12234245 - 12234145
Alignment:
| Q |
177 |
ttggagtaccttcacatgctgggaatcatttacagagatctaaagcctgagaatgtgttagttcgatcagacggtcacattatgctttcagatttcgatc |
276 |
Q |
| |
|
||||||||| | |||||||| |||||||| |||||||| || ||||| ||||| ||||| || || ||| |||||||| ||||| || |||||||||| |
|
|
| T |
12234245 |
ttggagtacttgcacatgcttggaatcatctacagagaccttaagcccgagaacgtgttggtgagagaagatggtcacataatgctatcggatttcgatc |
12234146 |
T |
|
| Q |
277 |
t |
277 |
Q |
| |
|
| |
|
|
| T |
12234145 |
t |
12234145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University