View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10375_1 (Length: 341)
Name: NF10375_1
Description: NF10375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10375_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 1 - 328
Target Start/End: Original strand, 39849754 - 39850081
Alignment:
| Q |
1 |
taccatcagtttcgagacaaatccggcactgaatttgttcggaaggaccggcttcgaggtcgatcgaggaaggatcgacgggaggaagaggtgggacgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39849754 |
taccatcagtttcgagacaaatccggcactgaatttgttcggaaggaccggcttcgaggtcgatcgaggaaggatcgacgggaggaagaggtgggacgag |
39849853 |
T |
|
| Q |
101 |
aggagaggtgtctgattctgagtgatcggccattaaaattgagcggaggaggatagaaatgtcacatgagagattcaatcaagaattatgaatttgatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39849854 |
aggagaggtgtctgattctgagtgatcggccattgaaattgagcggaggagggtagaaatgtcacatgagagattcaatcaagaattatgaatttgatta |
39849953 |
T |
|
| Q |
201 |
gagaaagagaagaagaatttcactgttcttcttcctctctctagctatctttctttctattcaactctgaacagtgattaattttcaagtttcagtcatt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39849954 |
gagaaagagaagaagaatttcactgttcttcttcctctctctagctatctttctttctattcaactctgaacagtgattaattttcaagtttcggtcatt |
39850053 |
T |
|
| Q |
301 |
aattaatctacactttcacacacaggtt |
328 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
39850054 |
aattaatctacactttcacacacaggtt |
39850081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University