View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10375_low_1 (Length: 206)
Name: NF10375_low_1
Description: NF10375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10375_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 32; Significance: 0.000000004; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 86 - 117
Target Start/End: Original strand, 32968591 - 32968622
Alignment:
| Q |
86 |
tgaagttttggtctcctattctaaaaatcgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32968591 |
tgaagttttggtctcctattctaaaaatcgga |
32968622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 70
Target Start/End: Original strand, 32968515 - 32968557
Alignment:
| Q |
28 |
agcagagatgcggaatgcttaaatgcattttttacccttatat |
70 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
32968515 |
agcacagatgcagaatgcttaaatgcattttttatccttatat |
32968557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University