View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10376_high_15 (Length: 225)
Name: NF10376_high_15
Description: NF10376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10376_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 22314124 - 22313913
Alignment:
| Q |
1 |
gtaaccctggaaacccatcaatcttgatcactgcaacaaacttttgccctccaaattttgctcaacctagtgacaatggtggctggtgcaacccacctag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22314124 |
gtaaccctggaaacccatcaatcttgatcactgcaacaaacttttgccctccaaattttgctcaacctagtgacaatggtggctggtgcaacccacctag |
22314025 |
T |
|
| Q |
101 |
acctcactttgatcttgctatgcctatgttccttaagatcgctcaatatcgtgccggaatcgtccccgtcgcttaccgccggtgagtttgatcacaaact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22314024 |
acctcactttgatcttgctatgcctatgttccttaagatcgctcaatatcgtgccggaatcgtccccgtcgcttaccgccggtgagtttgatcacaaacc |
22313925 |
T |
|
| Q |
201 |
cttcttttgtct |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
22313924 |
cttcttttgtct |
22313913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 30 - 113
Target Start/End: Complemental strand, 45506969 - 45506886
Alignment:
| Q |
30 |
actgcaacaaacttttgccctccaaattttgctcaacctagtgacaatggtggctggtgcaacccacctagacctcactttgat |
113 |
Q |
| |
|
||||| ||||| ||||| || ||||| ||||| | |||| |||||||||||| ||||| || || |||||||||||||||||| |
|
|
| T |
45506969 |
actgccacaaatttttgtccaccaaactttgcactccctaatgacaatggtggttggtgtaatccccctagacctcactttgat |
45506886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 30 - 113
Target Start/End: Complemental strand, 45512429 - 45512346
Alignment:
| Q |
30 |
actgcaacaaacttttgccctccaaattttgctcaacctagtgacaatggtggctggtgcaacccacctagacctcactttgat |
113 |
Q |
| |
|
||||| ||||| ||||| || ||||| ||||| | |||| |||||||||||| ||||| || || |||||||||||||||||| |
|
|
| T |
45512429 |
actgccacaaatttttgtccaccaaactttgcactccctaatgacaatggtggttggtgtaatccccctagacctcactttgat |
45512346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 39 - 166
Target Start/End: Complemental strand, 41491096 - 41490969
Alignment:
| Q |
39 |
aacttttgccctccaaattttgctcaacctagtgacaatggtggctggtgcaacccacctagacctcactttgatcttgctatgcctatgttccttaaga |
138 |
Q |
| |
|
|||||||| ||||| || |||||||||||||||||||||||||| ||||| ||||| ||| | ||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
41491096 |
aacttttgtcctcctaactttgctcaacctagtgacaatggtggttggtgtaaccctcctcgtcctcactttgatcttgccatgcctatgttccttaaaa |
41490997 |
T |
|
| Q |
139 |
tcgctcaatatcgtgccggaatcgtccc |
166 |
Q |
| |
|
||||| |||||||||||||||||||||| |
|
|
| T |
41490996 |
tcgctgaatatcgtgccggaatcgtccc |
41490969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 30 - 188
Target Start/End: Complemental strand, 23858729 - 23858571
Alignment:
| Q |
30 |
actgcaacaaacttttgccctccaaattttgctcaacctagtgacaatggtggctggtgcaacccacctagacctcactttgatcttgctatgcctatgt |
129 |
Q |
| |
|
||||| || |||||||| ||||| |||||||||||| | ||||| |||||||| ||||| ||||| ||| | ||||| |||||||||||||||||||||| |
|
|
| T |
23858729 |
actgctactaacttttgtcctcctaattttgctcaagcaagtgataatggtggttggtgtaaccctcctcgtcctcattttgatcttgctatgcctatgt |
23858630 |
T |
|
| Q |
130 |
tccttaagatcgctcaatatcgtgccggaatcgtccccgtcgcttaccgccggtgagtt |
188 |
Q |
| |
|
| |||||||| || | |||||||| || || ||||| || ||||||||| ||| |||| |
|
|
| T |
23858629 |
ttcttaagattgccgagtatcgtgctggtattgtccctgttgcttaccgcaggttagtt |
23858571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 30 - 154
Target Start/End: Complemental strand, 34207755 - 34207631
Alignment:
| Q |
30 |
actgcaacaaacttttgccctccaaattttgctcaacctagtgacaatggtggctggtgcaacccacctagacctcactttgatcttgctatgcctatgt |
129 |
Q |
| |
|
||||| ||||| ||||| || ||||||||||||||| | ||||| ||||| || ||||| ||||| || |||| ||||||||||||||||||||||||| |
|
|
| T |
34207755 |
actgctacaaatttttgtccaccaaattttgctcaagcaagtgataatggaggttggtgtaaccctccacgaccacactttgatcttgctatgcctatgt |
34207656 |
T |
|
| Q |
130 |
tccttaagatcgctcaatatcgtgc |
154 |
Q |
| |
|
|||| || || |||||||||||||| |
|
|
| T |
34207655 |
tcctcaaaattgctcaatatcgtgc |
34207631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University