View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10376_low_20 (Length: 225)

Name: NF10376_low_20
Description: NF10376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10376_low_20
NF10376_low_20
[»] chr7 (3 HSPs)
chr7 (1-212)||(22313913-22314124)
chr7 (30-113)||(45506886-45506969)
chr7 (30-113)||(45512346-45512429)
[»] chr2 (1 HSPs)
chr2 (39-166)||(41490969-41491096)
[»] chr4 (1 HSPs)
chr4 (30-188)||(23858571-23858729)
[»] chr5 (1 HSPs)
chr5 (30-154)||(34207631-34207755)


Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 22314124 - 22313913
Alignment:
1 gtaaccctggaaacccatcaatcttgatcactgcaacaaacttttgccctccaaattttgctcaacctagtgacaatggtggctggtgcaacccacctag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22314124 gtaaccctggaaacccatcaatcttgatcactgcaacaaacttttgccctccaaattttgctcaacctagtgacaatggtggctggtgcaacccacctag 22314025  T
101 acctcactttgatcttgctatgcctatgttccttaagatcgctcaatatcgtgccggaatcgtccccgtcgcttaccgccggtgagtttgatcacaaact 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
22314024 acctcactttgatcttgctatgcctatgttccttaagatcgctcaatatcgtgccggaatcgtccccgtcgcttaccgccggtgagtttgatcacaaacc 22313925  T
201 cttcttttgtct 212  Q
    ||||||||||||    
22313924 cttcttttgtct 22313913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 30 - 113
Target Start/End: Complemental strand, 45506969 - 45506886
Alignment:
30 actgcaacaaacttttgccctccaaattttgctcaacctagtgacaatggtggctggtgcaacccacctagacctcactttgat 113  Q
    ||||| ||||| ||||| || ||||| ||||| |  |||| |||||||||||| ||||| || || ||||||||||||||||||    
45506969 actgccacaaatttttgtccaccaaactttgcactccctaatgacaatggtggttggtgtaatccccctagacctcactttgat 45506886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 30 - 113
Target Start/End: Complemental strand, 45512429 - 45512346
Alignment:
30 actgcaacaaacttttgccctccaaattttgctcaacctagtgacaatggtggctggtgcaacccacctagacctcactttgat 113  Q
    ||||| ||||| ||||| || ||||| ||||| |  |||| |||||||||||| ||||| || || ||||||||||||||||||    
45512429 actgccacaaatttttgtccaccaaactttgcactccctaatgacaatggtggttggtgtaatccccctagacctcactttgat 45512346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 39 - 166
Target Start/End: Complemental strand, 41491096 - 41490969
Alignment:
39 aacttttgccctccaaattttgctcaacctagtgacaatggtggctggtgcaacccacctagacctcactttgatcttgctatgcctatgttccttaaga 138  Q
    |||||||| ||||| || |||||||||||||||||||||||||| ||||| ||||| ||| | ||||||||||||||||| ||||||||||||||||| |    
41491096 aacttttgtcctcctaactttgctcaacctagtgacaatggtggttggtgtaaccctcctcgtcctcactttgatcttgccatgcctatgttccttaaaa 41490997  T
139 tcgctcaatatcgtgccggaatcgtccc 166  Q
    ||||| ||||||||||||||||||||||    
41490996 tcgctgaatatcgtgccggaatcgtccc 41490969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 30 - 188
Target Start/End: Complemental strand, 23858729 - 23858571
Alignment:
30 actgcaacaaacttttgccctccaaattttgctcaacctagtgacaatggtggctggtgcaacccacctagacctcactttgatcttgctatgcctatgt 129  Q
    ||||| || |||||||| ||||| |||||||||||| | ||||| |||||||| ||||| ||||| ||| | ||||| ||||||||||||||||||||||    
23858729 actgctactaacttttgtcctcctaattttgctcaagcaagtgataatggtggttggtgtaaccctcctcgtcctcattttgatcttgctatgcctatgt 23858630  T
130 tccttaagatcgctcaatatcgtgccggaatcgtccccgtcgcttaccgccggtgagtt 188  Q
    | |||||||| ||  | |||||||| || || ||||| || ||||||||| ||| ||||    
23858629 ttcttaagattgccgagtatcgtgctggtattgtccctgttgcttaccgcaggttagtt 23858571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 30 - 154
Target Start/End: Complemental strand, 34207755 - 34207631
Alignment:
30 actgcaacaaacttttgccctccaaattttgctcaacctagtgacaatggtggctggtgcaacccacctagacctcactttgatcttgctatgcctatgt 129  Q
    ||||| ||||| ||||| || ||||||||||||||| | ||||| ||||| || ||||| ||||| ||  |||| |||||||||||||||||||||||||    
34207755 actgctacaaatttttgtccaccaaattttgctcaagcaagtgataatggaggttggtgtaaccctccacgaccacactttgatcttgctatgcctatgt 34207656  T
130 tccttaagatcgctcaatatcgtgc 154  Q
    |||| || || ||||||||||||||    
34207655 tcctcaaaattgctcaatatcgtgc 34207631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University