View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10376_low_3 (Length: 398)
Name: NF10376_low_3
Description: NF10376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10376_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 22 - 385
Target Start/End: Original strand, 44348750 - 44349112
Alignment:
| Q |
22 |
gtggtagatgatatcaaaaggctgtcttggaaatggagtttatcgaggcttaaaattcagccgtgtatgtattatgagtggttatgggatccgaggtggt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44348750 |
gtggtagatgatatcaaaaggctgtcttggaa-tggagtttatcgaggcttaaaattcagccgtgtttgtattatgagtggttatgggatccgaggtggt |
44348848 |
T |
 |
| Q |
122 |
gtcttggtgccttgggtggctaaggatggtgtgtcgggttggtgtggttgttggcaggaggggtggcggcagtggcagcctgcataattctgcaggttgt |
221 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44348849 |
gtcttggtgccttgggtggctaaggctggtgtgtcgggttggtgtggttgttggcaggaggggtggcggcagtggcagcctgcataattctgcaggttgt |
44348948 |
T |
 |
| Q |
222 |
tgtctgttgttttgtgctgcagcagctagtttgtgctgctgctggttgaggggtgggtttttgcttctgccagctgctgtcttttggtttcagtgtttgt |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44348949 |
tgtctgttgttttgtgctgcagcagctagtttgtgctgctgctggttgaggggtgggtttttgtttctgctagctgctgtcttttggtttcagtgtttgt |
44349048 |
T |
 |
| Q |
322 |
atagaaactttaggaggnnnnnnnatcaagtttggttgttggtgaggtgccgtgctttggccct |
385 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44349049 |
atagaaactttaggaggtttttttatcaagtttggttgttggtgaggtgccgtgttttggccct |
44349112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University