View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10376_low_8 (Length: 288)
Name: NF10376_low_8
Description: NF10376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10376_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 10977141 - 10976873
Alignment:
| Q |
1 |
taatcatgttgttgctctttgaagatgagctcctcaaaatcaaactgaatagcctcatgtgcaacagtgtgctcaagttcaaccctctccatatggttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10977141 |
taatcatgttgttgctctttgaagatgagctcctcaaaatcaaactgaatagcctcatgtgcaacagtgtgctcaagttcaaccctctccatatggttat |
10977042 |
T |
 |
| Q |
101 |
ggtgttccatggtgtctccttcaatcgcatcatctgcaacacattgaagcgacctattggaatgtgcattgctttctagagatccatcatggaatttatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10977041 |
ggtgttccatggtgtctccttcaatcgcatcatctgcaacacattgaagcgacctattggaatgtgcattgctttctagagatccatcatggaatttatt |
10976942 |
T |
 |
| Q |
201 |
tgattcataaggataatctatcaaaacgaggccaagcttgtggcatgttgcgtcctcctactgcctatg |
269 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10976941 |
tcattcataaggataatctatcaaaacgaggccaagcttgtggcatgttgcgtcctcctactgcctatg |
10976873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University