View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10378_high_7 (Length: 288)
Name: NF10378_high_7
Description: NF10378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10378_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 43143211 - 43143050
Alignment:
| Q |
1 |
caatgatgacgccacttccttatattattttatttggtatgtcaactccttttgtaatcttaggcattgcttttgcaaatggttggattaaggtaccaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43143211 |
caatgatgacgccacttccttatattattttatttggtatgtcaactccttttgtaatcttaggcattgcttttgcaaatggttggattaaggtaccaat |
43143112 |
T |
 |
| Q |
101 |
tagatagatgaggtcacacatttcattgttatgtgttcattctcattagtaatacttttcaa |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43143111 |
tagatagatgaggtcacacatttcattgttatgtgttcattctcattagtaatacttctcaa |
43143050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 43143024 - 43142969
Alignment:
| Q |
162 |
actttttcacatatatgtaacggtacaaacattatgtcagcaatattcaattccag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43143024 |
actttttcacatatatgtaacggtacaaatattatgtcagcaatattcaattccag |
43142969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University