View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10378_low_18 (Length: 250)
Name: NF10378_low_18
Description: NF10378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10378_low_18 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 9359480 - 9359250
Alignment:
| Q |
1 |
attatttggcatgcaactatttgggctatttggcaagctaggaatcatatgatcttccgaaatgaggtgaagcatgtggatgatctcttgtcggagattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9359480 |
attatttggcatgcaactatttgggctatttggcaagctaggaatcatatgatcttccgaaatgaggtgaagcatgtggatgatcttttgtcggagattg |
9359381 |
T |
 |
| Q |
101 |
ttgttaattcaaggcggtggagtttgtctaggcttgatatgcaaacatgcttatattatgaatggaattggaatccacaagaatgtctattaaggaagta |
200 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9359380 |
ttgttaattcgtggcggtggagtttgtataggcttgatatgcaaacatgcttatattatgaatggaattggaatccacaagaatgtctattaaggaagta |
9359281 |
T |
 |
| Q |
201 |
attggttttggagctgttttatgttgctgtt |
231 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |
|
|
| T |
9359280 |
attggttttggagctgttttttgttgctgtt |
9359250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 2 - 47
Target Start/End: Complemental strand, 53112111 - 53112066
Alignment:
| Q |
2 |
ttatttggcatgcaactatttgggctatttggcaagctaggaatca |
47 |
Q |
| |
|
|||| ||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
53112111 |
ttatatggcatgcaacggtttggggtatttggcaagctaggaatca |
53112066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 4 - 200
Target Start/End: Complemental strand, 32915386 - 32915190
Alignment:
| Q |
4 |
atttggcatgcaactatttgggctatttggcaagctaggaatcatatgatcttccgaaatgaggtgaagcatgtggatgatctcttgtcggagattgttg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||| || || ||||||||||| |||||||||||||| ||| |||| ||||| | |
|
|
| T |
32915386 |
atttggcatgcaactatttgggctatttggcaagcgaggaatcatttgatttttcgtaatgaggtgaaacatgtggatgatcttttggcggaaattgtgg |
32915287 |
T |
 |
| Q |
104 |
ttaattcaaggcggtggagtttgtctaggcttgatatgcaaacatgcttatattatgaatggaattggaatccacaagaatgtctattaaggaagta |
200 |
Q |
| |
|
|||||||| ||||||||||||||| |||||| |||| ||| |||| |||| ||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
32915286 |
ttaattcatggcggtggagtttgtgtaggctgaatatacaagcatgtttattttatgaatggaattggaatcctcaagaatgtctatcgaggaagta |
32915190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 24945373 - 24945467
Alignment:
| Q |
1 |
attatttggcatgcaactatttgggctatttggcaagctaggaatcatatgatcttccgaaatgaggtgaagcatgtggatgatctcttgtcgga |
95 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||| |||||| || ||||| ||||||||||| ||||||||||| | |||||||| |
|
|
| T |
24945373 |
attatttggcatgcaactatttggtcaatttggcaagctagaaatcattgtattttccggaatgaggtgaaatatgtggatgatttattgtcgga |
24945467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 4 - 189
Target Start/End: Original strand, 2308164 - 2308349
Alignment:
| Q |
4 |
atttggcatgcaactatttgggctatttggcaagctaggaatcatatgatcttccgaaatgaggtgaagcatgtggatgatctcttgtcggagattgttg |
103 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||| ||| ||| |||| |||||||| | |||||||| ||| | ||| |||||||||| | |
|
|
| T |
2308164 |
atttggcatgcaactatatgggctatttggcaagcgaggaaccattcgattttccttaatgaggtaatacatgtggaagatattttggcggagattgtgg |
2308263 |
T |
 |
| Q |
104 |
ttaattcaaggcggtggagtttgtctaggcttgatatgcaaacatgcttatattatgaatggaattggaatccacaagaatgtcta |
189 |
Q |
| |
|
| |||||| || |||||||||||||||| ||| |||||||||| || ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2308264 |
taaattcatggaggtggagtttgtctagacttaatatgcaaacctgtctatattatgaatggaattggaatcctcaagaatgtcta |
2308349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 520213 - 520028
Alignment:
| Q |
1 |
attatttggcatgcaactatttgggctatttggcaagctaggaatcatatgatcttccgaaatgaggtgaagcatgtggatgatctcttgtcggagattg |
100 |
Q |
| |
|
||||||||| |||||||||||||| | ||||||||||| || |||||| | || ||||| ||||||||||| ||||||||| | |||||||| || |
|
|
| T |
520213 |
attatttgggatgcaactatttggtcaatttggcaagcgagaaatcattttatattccggaatgaggtgaaatctgtggatgaattattgtcggaaataa |
520114 |
T |
 |
| Q |
101 |
ttgttaattcaaggcggtggagtttgtctaggcttgatatgcaaacatgcttatattatgaatggaattggaatccacaagaatgt |
186 |
Q |
| |
|
| || || ||||||||| ||||| ||||||||| ||||||||| || |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
520113 |
tggtgttgtcgaggcggtggtgtttgactaggcttgttatgcaaacttgtctatactatgaatggaattggaatcctcaagaatgt |
520028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 113 - 208
Target Start/End: Original strand, 43805529 - 43805624
Alignment:
| Q |
113 |
ggcggtggagtttgtctaggcttgatatgcaaacatgcttatattatgaatggaattggaatccacaagaatgtctattaaggaagtaattggttt |
208 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| || |||||||||||||| | ||||||||| ||||| || || || |||||||| ||||||| |
|
|
| T |
43805529 |
ggcggtggagtttgtataggcttaatatgcaaacttgtttatattatgaatgaagttggaatcctcaagagtgccttttgaggaagtagttggttt |
43805624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 188
Target Start/End: Original strand, 26209499 - 26209533
Alignment:
| Q |
154 |
tattatgaatggaattggaatccacaagaatgtct |
188 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26209499 |
tattatgaatggagttggaatccacaagaatgtct |
26209533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 188
Target Start/End: Original strand, 26232059 - 26232091
Alignment:
| Q |
156 |
ttatgaatggaattggaatccacaagaatgtct |
188 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
26232059 |
ttatgaatggagttggaatccacaagaatgtct |
26232091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 41195255 - 41195218
Alignment:
| Q |
1 |
attatttggcatgcaactatttgggctatttggcaagc |
38 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
41195255 |
attatttggcatgctactatttgggttatttggcaagc |
41195218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University