View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10378_low_28 (Length: 210)
Name: NF10378_low_28
Description: NF10378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10378_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 142 - 188
Target Start/End: Original strand, 5166550 - 5166596
Alignment:
| Q |
142 |
gagatgaatttatatactgttgttctattgaccagtgcggtcaacgt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5166550 |
gagatgaatttatatactgttgttctattgaccagtgcggtcaacgt |
5166596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 56
Target Start/End: Original strand, 5166423 - 5166461
Alignment:
| Q |
18 |
tatcattgttttgaagaatagagaaatgaaaataaatca |
56 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
5166423 |
tatccttgttttgaagaatagagaaatgaaattaaatca |
5166461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University