View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10379_high_16 (Length: 264)
Name: NF10379_high_16
Description: NF10379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10379_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 48098060 - 48098305
Alignment:
| Q |
1 |
atgaatatgggtgcacctcacgtggaagtcgcaattgcatgcttgtctacgggtatgtatctaatggaactgtggctgatcacgttcatggcaacaaagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
48098060 |
atgaatatgggtgcacctcacgtggaagtcgcaattgcatgcttgtctacgggtatgtatctaatggaactgtggctaatcaccttcatggcaacaaagc |
48098159 |
T |
 |
| Q |
101 |
aatagagggaaaattaacttagaaggttaggatgaatattgtagtggagaccactagagcactaaaacatcttcatgcttctaacgacattaaaaccaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48098160 |
aatagagggaaaattaacttagaaggttaggatgaatattgtagtggagaccactagagcactaaaacatcttcatgcttctaacgacattaaaaccaga |
48098259 |
T |
 |
| Q |
201 |
aatattcctcttgacattgattttcatgcaaaagtaagagattttt |
246 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48098260 |
aataatcctcttgacattgattttcatgcaaaagtaagagattttt |
48098305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University