View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10379_high_20 (Length: 235)
Name: NF10379_high_20
Description: NF10379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10379_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 13 - 162
Target Start/End: Complemental strand, 9343606 - 9343459
Alignment:
| Q |
13 |
gcagagatttcctaaagaatacattcttgtataagtgaaatttgcatgtgccttcatttcactttttcatatgaatgtaggnnnnnnnnnctctaacata |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || ||| |||||||||| |
|
|
| T |
9343606 |
gcagagatttcctaaagaatacattcttgtataagtgaaatttgcatgtgccttcatttaactttttcatataaaagta--tttttttttctctaacata |
9343509 |
T |
|
| Q |
113 |
ggaattagttaattaactgaaactagaagttaaacttaaactagggcata |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9343508 |
ggaattagttaattaactgaaactagaagttaaactcaaactagggcata |
9343459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 161 - 215
Target Start/End: Complemental strand, 9343426 - 9343372
Alignment:
| Q |
161 |
tattgtaaggactgtatgtttttgaggttatttgtccattctgctatctgcttta |
215 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9343426 |
tattgtaaggactatatgtttttgaggttatttttccattctgctatctgcttta |
9343372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University