View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10379_high_6 (Length: 416)
Name: NF10379_high_6
Description: NF10379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10379_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 52 - 409
Target Start/End: Complemental strand, 37170559 - 37170183
Alignment:
| Q |
52 |
tcaatttctaggttattgattttgcgtgtttttggttgttctactatggtgaaat-------------------caaatctagagaaccacaaaatacca |
132 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37170559 |
tcaatttctaggttattgattttgcgtgtgtttggttgttctgctatggtgaaatattatttccaacttagaatcaaatctagagaaccacaaaatacca |
37170460 |
T |
 |
| Q |
133 |
aactcaattttaatttttaaatacaattacttttgattcaaagctgcacttgttgataaattgggtattaagagggaaatgaagttgtttgtagtttcta |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |||||||||||||||| |
|
|
| T |
37170459 |
aactcaattttaatttttaaatacaattacttttgattcaaagctgcacttgttgataaattgggtattaagaggggattgaacttgtttgtagtttcta |
37170360 |
T |
 |
| Q |
233 |
aactatggcgnnnnnnngttttgagtgtttcaggtgggaattgcctgaagcaaaacatggggtttcagcttctactgctaatgaattgcgtcaggatcgg |
332 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37170359 |
aactatggcgtttttttgttttgagtgtttcaggtgggaattgcctgaagcaaaacatggggtttcagcttctactgccaatgaattgcgtcaggatcgg |
37170260 |
T |
 |
| Q |
333 |
tatgatgtctatgttaacccggaaaagttgaaagcagcatctgaagggcttgcaaatcgtatgtatcattcttctca |
409 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37170259 |
tatgacgtcaatgttaacccggaaaagttgaaagcagcatctgaagggcttgcaaatcgtatgtatcattcttctca |
37170183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University