View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10379_low_30 (Length: 236)
Name: NF10379_low_30
Description: NF10379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10379_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 6 - 119
Target Start/End: Complemental strand, 743443 - 743326
Alignment:
| Q |
6 |
caaaggatattgaatttattttaaggaagagagtgaaactggaagttgaacttctttctttg----gggaaaaaagacgacaacgctagcaaagttcgtc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
743443 |
caaaggatattgaatttattttaaggaagagagtgaaactggaagttgaacttctttctttgggccgggaaaaaagacgacaacgctagcaaagttcgtc |
743344 |
T |
|
| Q |
102 |
ttgcagatgtaagtatgg |
119 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
743343 |
ttgcagatgtaagtatgg |
743326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 42450710 - 42450594
Alignment:
| Q |
1 |
tcagccaaaggatattgaatttattttaaggaagagagtgaaactggaagttgaacttctttctttggggaaaaaagacgacaacgctagcaaagttcgt |
100 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||| |||||||||||||||| || |||||| |||||||||||||||| |||| |
|
|
| T |
42450710 |
tcagccaaaggatattgaacttattttgaggaagagagtgaaactggaagtggaacttctttctttggcgagaaaagatgacaacgctagcaaagctcgt |
42450611 |
T |
|
| Q |
101 |
cttgcagatgtaagtat |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42450610 |
cttgcagatgtaagtat |
42450594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University