View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10379_low_36 (Length: 204)
Name: NF10379_low_36
Description: NF10379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10379_low_36 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 672844 - 672647
Alignment:
| Q |
1 |
cctagttttttgactcctatgctgatcatgttgatcttgttcttggtgatccctttttctctttgccacactgcaagtgcaagatgagggactcatgttt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
672844 |
cctagttttttgactcctatcctgatcatgttgatcttgttcttggtgatccctttctctctttgccacactgcaag------atgagggactcatgttt |
672751 |
T |
 |
| Q |
101 |
agattcccttatcctgagtttatgggtgctattaggagaataaaagttggtcagagttggttgatacaataaaaactctataaatgaagtgcctcttggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
672750 |
agattcccttatcctgagtttatgggtgctattaggagaataaaagttggtcagagttggttgatacaataaaaactccataaatgaagtgcctcttggc |
672651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University