View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10379_low_38 (Length: 203)
Name: NF10379_low_38
Description: NF10379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10379_low_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 3160419 - 3160608
Alignment:
| Q |
1 |
gtatgtcatttttgttgtatgctcggtagattgttgttccacaacttattgtcaagttgatggaacataaaaatggcaacatagtttgaaccattttgtt |
100 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
3160419 |
gtatatcatttttgttgtatgcacggtagattgttgttccacaacttattgtcaagttgagggaacataaaaatggtaacatactttgaaccattttgtt |
3160518 |
T |
 |
| Q |
101 |
cggatgatgcatattagaaagtaatagttgtgatgagtacacattcgtagcttctttttgagtgttcatcaaatatttttgtgtaaactg |
190 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3160519 |
gggatgatgcatattagaaagtaatagttgcgatggatacacattaatagcttctttctgagtgttcatcaaatatttttgtgtaaactg |
3160608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University