View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10379_low_8 (Length: 410)
Name: NF10379_low_8
Description: NF10379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10379_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 1 - 397
Target Start/End: Original strand, 13087598 - 13087994
Alignment:
| Q |
1 |
tatacacgctatatgtaaagactggatcaatcatcaaaggaggaacagattcaaaaatcagcattagattcgacgatgcaaagaaccaatcagtatggat |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13087598 |
tatacacaatatatgtaaagactggatcaatcatcaaaggtggaacagattcgaaaatcagcattagattcgacgatgcaaagaaccaatcagtgtggat |
13087697 |
T |
|
| Q |
101 |
cccaaacctaaaatcatggggtgcaatgggagaaggtcataactacttcgagcgcggaaatgtggatgccttcaccggacgtggaccatgcatcaaatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
13087698 |
cccaaacctaaaatcatggggtgcaatgggagaaggtcataactacttcgagcgtggaaatgtggatgccttcaccggacgtggaccatgcatcaactca |
13087797 |
T |
|
| Q |
201 |
cgtgtttgccgcctcaacctcgcctcagacggatctgggtaccaccatgggtggtactgcgactacgtggaggtcacctccactggtccccacaaacctt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13087798 |
cgtgtttgccgcctcaacctcgcctcagacggatctgggtaccaccatgggtggtactgcgactacgtggaggtcacctccactggtccccacaaacctt |
13087897 |
T |
|
| Q |
301 |
gttcccaaaccatcttctatgttgatgagtggcttgccaaagatgttgcaccctataacctcagtgttatcattgatcgttgtcgtctctctgctcc |
397 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13087898 |
gttcccaaaccatcttctatgttgatcagtggcttgccaaagatgttgcaccctataacctcagtgttatcattgatcgttgtcgtctcactgctcc |
13087994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University