View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1037_high_2 (Length: 321)

Name: NF1037_high_2
Description: NF1037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1037_high_2
NF1037_high_2
[»] chr2 (1 HSPs)
chr2 (100-308)||(41508734-41508942)


Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 100 - 308
Target Start/End: Complemental strand, 41508942 - 41508734
Alignment:
100 gtcgaatcctcccgtcactcgtgatcgtgatttcaggctctttaagcaatgggttccatggcttattccaacttttgtgtttgccaacgttgttgttttc 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41508942 gtcgaatcctcccgtcactcgtgatcgtgatttcaggctctttaagcaatgggttccatggcttattccaacttttgtgtttgccaacgttgttgttttc 41508843  T
200 atttttacaatgtatgttaatgattgtcctgagaatgcatttcatggcacttgtgttgctccttttcttggaagattctcatttcaaccacttaaagaaa 299  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
41508842 atttttacaatgtatgttaatgattgtcctgagaatgcatttcatggcacttgtgttgctccttttcttggaaggttctcatttcaaccacttaaagaaa 41508743  T
300 accctctct 308  Q
    |||||||||    
41508742 accctctct 41508734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University