View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1037_low_5 (Length: 321)
Name: NF1037_low_5
Description: NF1037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1037_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 100 - 308
Target Start/End: Complemental strand, 41508942 - 41508734
Alignment:
| Q |
100 |
gtcgaatcctcccgtcactcgtgatcgtgatttcaggctctttaagcaatgggttccatggcttattccaacttttgtgtttgccaacgttgttgttttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41508942 |
gtcgaatcctcccgtcactcgtgatcgtgatttcaggctctttaagcaatgggttccatggcttattccaacttttgtgtttgccaacgttgttgttttc |
41508843 |
T |
 |
| Q |
200 |
atttttacaatgtatgttaatgattgtcctgagaatgcatttcatggcacttgtgttgctccttttcttggaagattctcatttcaaccacttaaagaaa |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41508842 |
atttttacaatgtatgttaatgattgtcctgagaatgcatttcatggcacttgtgttgctccttttcttggaaggttctcatttcaaccacttaaagaaa |
41508743 |
T |
 |
| Q |
300 |
accctctct |
308 |
Q |
| |
|
||||||||| |
|
|
| T |
41508742 |
accctctct |
41508734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University