View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1037_low_8 (Length: 289)
Name: NF1037_low_8
Description: NF1037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1037_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 46 - 194
Target Start/End: Original strand, 40311718 - 40311867
Alignment:
| Q |
46 |
aaacaaaggtggtgaacgttgaaaatgacatgagtagtgtagggctatgtaa-catgtcattagaaacaaacaacaaggacaattacgtaaatgaattga |
144 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40311718 |
aaacaaaggtggtgaatgttgaaaatgacatgagtagtgtagggctatgtaaacatgtcattagaaacaaacaacaaggacaattacgtaaatgaattga |
40311817 |
T |
 |
| Q |
145 |
actaaaaaagaaagctctgttttgagaaatcgatatgcgtgcaatacaaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40311818 |
actaaaaaagaaagctctgttttgagaaatcgatatgcgtgcaatacaaa |
40311867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University