View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10380_low_25 (Length: 243)
Name: NF10380_low_25
Description: NF10380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10380_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 12 - 226
Target Start/End: Complemental strand, 47503 - 47289
Alignment:
| Q |
12 |
aagaatcaagaacaactatcactgtcaactcaagataaatgtcaaacaaatattttagagtcaaggttagaaagcaattacaaacttccaccgcgaccct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47503 |
aagaatcaagaacaactatcactgtcaactcaagataaatgtcaaacaaatattttagagtcaaggttagaaagcaattacaaacttccaccgcgaccct |
47404 |
T |
 |
| Q |
112 |
ggctcttggtaagtaatgaatatgtttcacattccaatcaagataaaatctatatgcaaaaatcaactgcagagtgtgtaataggtgaatgtgaaaatac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47403 |
ggctcttggtaagtaatgaatatgtttcacattccaatcaagataaaatctatatgcaaaaatcaactgcagagtgtgtaataggtgaatgtgaaaatac |
47304 |
T |
 |
| Q |
212 |
agaagcacaatgttc |
226 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47303 |
agaagcacaatgttc |
47289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University