View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10380_low_28 (Length: 238)
Name: NF10380_low_28
Description: NF10380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10380_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 32300815 - 32301039
Alignment:
| Q |
1 |
atgcttggagttaaaaaatttacat--gttttacatgaaatttgcttttattgtaaaatcatctaacataaaacgcttaatttcaaacacaatttttgcc |
98 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32300815 |
atgcttggagttaaaaaatttacatatgttttacatgaaatttgcttttattgtaaaatcatctaacataaaacgcttaatttcaaacacaatttttgcc |
32300914 |
T |
 |
| Q |
99 |
aaatcattttacaatatatttagttgaaaattgcacttctgaaatgttcatccaaagaatcacatacaaagcatacatgtgacatttagtagaagtcgtt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32300915 |
aaatcattttacaatatatttagttgaaaattgcacttctgaaatgttcatccaaagaatcacatacaaagcatacatgtgacatttagtagaagtcgat |
32301014 |
T |
 |
| Q |
199 |
tttcttgctatttgcagctcatgcc |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32301015 |
tttcttgctatttgcagctcatgcc |
32301039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University