View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10380_low_31 (Length: 229)
Name: NF10380_low_31
Description: NF10380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10380_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 7 - 225
Target Start/End: Complemental strand, 34085083 - 34084865
Alignment:
| Q |
7 |
aaaatgatcttcaagaattacttgagtgttttcttcagcttaatgcaaagtgtcaccatcatgtcattgttgaagcgttcatggagacatgtgaagaaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34085083 |
aaaatgatcttcaagaattacttgagtgttttcttcagcttaatgcaaagtgtcaccatcatgtcattgttgaagcgttcatggagacatgtgaagaaat |
34084984 |
T |
 |
| Q |
107 |
atttcctaagaagctttgtggtgatggtagacgtgtgtgaaggacatgtgaaggtattgaagtcacacatggaaattaatgctgcatgagaaatttgagg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34084983 |
atttcctaagaagctttgtggtgatggtagacgtgtgtgaaggacatgtgaaggcattgaagtcacacatggaaattaatgctgcatgagaaatttgagg |
34084884 |
T |
 |
| Q |
207 |
tttgaaattgatctaattc |
225 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34084883 |
tttgaaattgatctaattc |
34084865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University