View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10381_high_21 (Length: 205)
Name: NF10381_high_21
Description: NF10381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10381_high_21 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 186
Target Start/End: Complemental strand, 11514 - 11347
Alignment:
| Q |
19 |
aagggccccatatatcagcatgtaacaaatcaaaaatgttattagaatgagtaacactattaggataaggaagaactctttgtttggaaaaatgacaaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11514 |
aagggccccatatatcagcatgtaacaaatcaaaaatgttattagaatgagtaacactattaggataaggaagaactctttgtttggaaaaatgacaaac |
11415 |
T |
 |
| Q |
119 |
atcacaaggagtatttttattatgattcttgtaagaaataaaaggataagttgaagcaatacatttgt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11414 |
atcacaaggagtatttttattatgattcttgtaagaaataaaaggataagttgaagcaatacatttgt |
11347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University