View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10381_low_13 (Length: 355)
Name: NF10381_low_13
Description: NF10381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10381_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 9e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 81 - 312
Target Start/End: Original strand, 12498983 - 12499212
Alignment:
| Q |
81 |
taatttttaattgctttgttgttgttaggttatatgaatgttgttctttgcccctcaagaaaataaaggaagatgtgattgagcttattgaaacacatac |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12498983 |
taatttttaattgctttgttgttgttaggttatatgaatgttgttctttgcccctcaagaaaataaaggaagatgtgattgagcttattgaaacacatac |
12499082 |
T |
|
| Q |
181 |
cattagtttgtgaggtgaattaagcttttcttgcaaagcatttactccctccattacgtagaaagtgtcacttgcaaatg--nnnnnnngtctcaaaaca |
278 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
12499083 |
cattagtttgtgaggtga---aagcttttcttgc-aagcatttactccctccattacatagaaagtgtcacttgcaaatgaaaaaaaaagtctcaaaaca |
12499178 |
T |
|
| Q |
279 |
agtattgttttatattttcattgcaacattttat |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
12499179 |
agtattgttttatattttcattgcaacattttat |
12499212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 12497672 - 12497732
Alignment:
| Q |
20 |
cagagttagacgtgactgacgattatatacgcagctatttatgattcaccacttgatgctt |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12497672 |
cagagttagacgtgactgacgattatatacgcagctatttatgattcaccatttgatgctt |
12497732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University