View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10381_low_17 (Length: 313)
Name: NF10381_low_17
Description: NF10381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10381_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 6e-77; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 7 - 168
Target Start/End: Complemental strand, 40595769 - 40595608
Alignment:
| Q |
7 |
agtagcataggtgtttctttgcggccagattatcagcagaataaagcaaagcttatgttcatgcaagaagaggttgattttcttactactttctatataa |
106 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40595769 |
agtagcttgggtgtttctttgcggccagattatcagcagaataaagcaaagcttatgttcatgcaagaagaggttgattttcttactactttctatataa |
40595670 |
T |
|
| Q |
107 |
atctagtttaataatttgcttctatgactatttattttgcatcaaataatgtctgtctcaga |
168 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40595669 |
atctagtttaatgatttgcttctatgactatttattttgcattaaataatgtctgtctcaga |
40595608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 209 - 313
Target Start/End: Complemental strand, 40595575 - 40595471
Alignment:
| Q |
209 |
gccaaatgcctttatgctgttgtgtgcactgcaaaaagtagcaagttttaatttctgacaaggttaagttgcaaagataaataaattggttatgtatcac |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40595575 |
gccaaatgcctttatgctgttgtgtgcactgcaaaaagtagcaagttttaatttctgacaaggttaagttgcaaagataaataaattggttatgtatcac |
40595476 |
T |
|
| Q |
309 |
tctct |
313 |
Q |
| |
|
||||| |
|
|
| T |
40595475 |
tctct |
40595471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 166 - 199
Target Start/End: Complemental strand, 40595470 - 40595437
Alignment:
| Q |
166 |
agagagcatgaggaaacaaattatatctttgcat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40595470 |
agagagcatgaggaaacaaattatatctttgcat |
40595437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University