View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10381_low_20 (Length: 255)
Name: NF10381_low_20
Description: NF10381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10381_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 136 - 228
Target Start/End: Original strand, 6497022 - 6497114
Alignment:
| Q |
136 |
tttctgctgttttatttatcatcataggatataaacttaattgagatattactcataagctgaaaattctagagataacaagtgataaacaca |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6497022 |
tttctgctgttttatttatcatcataggatataaacttaattgtgatattactcataagctgaaaattctagagataacaagtgataaacaca |
6497114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 9 - 78
Target Start/End: Original strand, 6496912 - 6496981
Alignment:
| Q |
9 |
gatgaagatcacacttttgctaattctgttcgtttcaccttgaatcaagagttagtcttttcccaattct |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6496912 |
gatgaagatcacacttttgctaattctgttcgtttcatcttgaatcaagagttagtcttttcccaattct |
6496981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 9 - 84
Target Start/End: Original strand, 31731648 - 31731723
Alignment:
| Q |
9 |
gatgaagatcacacttttgctaattctgttcgtttcaccttgaatcaagagttagtcttttcccaattcttcttac |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31731648 |
gatgaagatcacacttttgctaattctgttcgtttcaccttgaatcaagagttagtcttttcccaattcttcttac |
31731723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 164 - 233
Target Start/End: Original strand, 31731828 - 31731897
Alignment:
| Q |
164 |
atataaacttaattgagatattactcataagctgaaaattctagagataacaagtgataaacacatgaat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31731828 |
atataaacttaattgagatattactcataagctgaaaattctagagataacaagtgattaacacatgaat |
31731897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 10 - 65
Target Start/End: Original strand, 31734575 - 31734630
Alignment:
| Q |
10 |
atgaagatcacacttttgctaattctgttcgtttcaccttgaatcaagagttagtc |
65 |
Q |
| |
|
||||||||||||||||| |||||||||| || ||||||||||||||||||| |||| |
|
|
| T |
31734575 |
atgaagatcacactttttctaattctgtccgattcaccttgaatcaagagtaagtc |
31734630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 62
Target Start/End: Original strand, 47463244 - 47463291
Alignment:
| Q |
15 |
gatcacacttttgctaattctgttcgtttcaccttgaatcaagagtta |
62 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
47463244 |
gatcacacttttgctaattctgtcagattcaccttgaatcaagagtta |
47463291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University