View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10381_low_9 (Length: 399)
Name: NF10381_low_9
Description: NF10381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10381_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 1e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 156 - 387
Target Start/End: Complemental strand, 46914617 - 46914386
Alignment:
| Q |
156 |
taaacgaactctgtttgtcacccacgatctctaccaacaacatcaaacaataaattccaagaaattacagcataccttttattttctttcacaaaaagat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46914617 |
taaacgaactctgtttgtcacccacgatctctaccaacaacatcaaacaataaattccaagaaattacagcatactttttattttctttcacaaaaagat |
46914518 |
T |
 |
| Q |
256 |
nnnnnnnncctagagattagtactatgataactgaaaacaaacaaaactatttaatctctgcaattatnnnnnnnncaaaacaacattgaaacaccaaaa |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46914517 |
aaaaaaaacctagagattagtactatgataactgaaaacaaacaaaactatttaaactctgcaattataaaaaaaacaaaacaacattgaaacaccaaaa |
46914418 |
T |
 |
| Q |
356 |
tgtccttctccaacccccaccaacacaccccc |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46914417 |
tgtccttctccaacccccaccaacacaccccc |
46914386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 46914750 - 46914672
Alignment:
| Q |
19 |
ccaatatgccctactaccataattgaagaaaaccaagcttattgtacatgagtttgtttgctagtatttgcagactctcttcc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46914750 |
ccaatatgccctactaccataattgaagaaaaccaagcttattg----tgagtttgtttgctagtatttgcagactctcttcc |
46914672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University