View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10382_high_11 (Length: 344)
Name: NF10382_high_11
Description: NF10382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10382_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 186 - 333
Target Start/End: Complemental strand, 4419298 - 4419150
Alignment:
| Q |
186 |
ggaatatagctcaaatcttcttaaaagtgccatggtagtgattcgtgaattccnnnnnnnnnn-gtgggatactagttgtaaaaataagatgatgttttt |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4419298 |
ggaatatagctcaaatcttcttaaaagtgccatggtagtgattcgtgaattcctttttttttttgtgggatactagttataaaaataagatgatgttttt |
4419199 |
T |
|
| Q |
285 |
ggcatatatggccagggatgacccaaaagaaaaggtcactaaggttctt |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4419198 |
ggcatatatggccagggatgacccaaaagaaaaggtcactaaggttctt |
4419150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 16 - 116
Target Start/End: Complemental strand, 4419478 - 4419378
Alignment:
| Q |
16 |
atatatattgcatgtatttgtatttgtacattgtattggaatatttcgaaaacatgcataattatattggatcactacaaagagatacaataatcacaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4419478 |
atatatattgcatgtatttgtatttgtacattgtattggaatatttcgaaaacatgcataattatattggatcactacaaagagatacaataatcacaca |
4419379 |
T |
|
| Q |
116 |
a |
116 |
Q |
| |
|
| |
|
|
| T |
4419378 |
a |
4419378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University