View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10382_high_12 (Length: 338)
Name: NF10382_high_12
Description: NF10382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10382_high_12 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 11 - 338
Target Start/End: Original strand, 42955584 - 42955911
Alignment:
| Q |
11 |
gagatgaaaaaacatttattatcaaagtacatgtaccc-acgagagtgtcatggaattgggcctatgggcatgcaaaattagaattagtcgggatgtcac |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42955584 |
gagatgaaaaaacattcattatcaaagtacatgtaccccacgagagtgtcatggaa--gggcctatgggcatgcaaaattagaattagtcgggatgtcac |
42955681 |
T |
 |
| Q |
110 |
ttgcatctagtaatggtcacaaatatgcatactaccagcgagaatatccgaatacaacggtcaatgctttatttttgtaggccacgatgcttgctagtag |
209 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
42955682 |
ttgcatctagtaatggtcacaaatacgcatactaccggcgagaatatccgaatacaacggtcaatgttttatttt-gtaggccacgatgcttgctagtag |
42955780 |
T |
 |
| Q |
210 |
ggttattagctcttcatgtaaattccgattgtaaatatcattttcgatagacacatttaatcaaaattttcattttctcacaatttacctttatc--ttt |
307 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
42955781 |
gattattagctcttcatgtaaattccgattgtaaatatcattttcgatagacacatttaatcaaatttttcattttctcacaatttacctttatcttttt |
42955880 |
T |
 |
| Q |
308 |
ctcttaacattttacttatgcattgattagt |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42955881 |
ctcttaacattttacttatgcattgattagt |
42955911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University