View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10382_high_13 (Length: 320)
Name: NF10382_high_13
Description: NF10382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10382_high_13 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 320
Target Start/End: Complemental strand, 37558876 - 37558557
Alignment:
| Q |
1 |
tcactagtcactagtgcaaaaggcttggaccattactaatttactatatagtttatatacatacttcactggtcactagtactgcaagaggcttggaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37558876 |
tcactagtcactagtgcaaaaggcttggaccattactaatttactatatagtttatatacatacttcactggtcactagtactgcaagaggcttggaaca |
37558777 |
T |
 |
| Q |
101 |
ttgctgtctatgcatcaaacttggttgctgctgcttcaattggtttgattgagtccaaaaaagggataacccttggatgcataggcaatagcattacctc |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37558776 |
ttgctgtctatgcatcaaacctggttgctgctgcttcaattggtttgattgagtccaaaaaagggataacccttggatgcataggcaatagcattacctc |
37558677 |
T |
 |
| Q |
201 |
nnnnnnnnnnnnnngagacctacccaaaagctagtatagtcatttggatttcccatttagcatatttaacgaacagtaagtatccaaatcaactgggaag |
300 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37558676 |
aaaaaccaaaaaaagagacctgcccaaaagctagtatagtcatttggatttcccatttagcatatttaacgaacaataagtatccaaatcaactgggaag |
37558577 |
T |
 |
| Q |
301 |
aagggatccttgagtgattt |
320 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
37558576 |
aagggatccttgagtgattt |
37558557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 45 - 105
Target Start/End: Complemental strand, 37558956 - 37558899
Alignment:
| Q |
45 |
tatatagtttatatacatacttcactggtcactagtactgcaagaggcttggaacattgct |
105 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
37558956 |
tatatagtttatatacatacttcactagtcac---tgctgcaagaggcttggaacattgct |
37558899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 45 - 195
Target Start/End: Original strand, 4444571 - 4444717
Alignment:
| Q |
45 |
tatatagtttatatacatacttcactggtcactagtactgcaagaggcttggaacattgctgtctatgcatcaaacttggttgctgctgcttcaattggt |
144 |
Q |
| |
|
||||||||||||||| |||||||| | ||||||| |||||||| ||||||||||||||| ||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
4444571 |
tatatagtttatatatatacttca-tagtcacta---ctgcaagaagcttggaacattgctatctatacatcaaacttggttgctgctgtctcaattggt |
4444666 |
T |
 |
| Q |
145 |
ttgattgagtccaaaaaagggataacccttggatgcataggcaatagcatt |
195 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4444667 |
ttgattgagtcacaaaaagggataacccttggatgcataggcaatagcatt |
4444717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 267 - 313
Target Start/End: Original strand, 4444756 - 4444802
Alignment:
| Q |
267 |
taacgaacagtaagtatccaaatcaactgggaagaagggatccttga |
313 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
4444756 |
taacgatcagtaagtatcgaaatcaactgggaagaagggattcttga |
4444802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University