View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10382_high_16 (Length: 279)
Name: NF10382_high_16
Description: NF10382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10382_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 36569434 - 36569696
Alignment:
| Q |
1 |
ggttatggtgttgggtgtaggggtggttgaggatggtgtttctccggtggaggagaggttgaaggcgaagacggttgcgtcttggaggatgaaacggggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36569434 |
ggttatggtgttgggtgtaggggtggttgaggatggtgtttctccggtggaggagaggttgaaggcgaagacggttgcgtcttggaggatgaaacggggt |
36569533 |
T |
 |
| Q |
101 |
ttggttggccggaggataatccaaataaggaagattacgaagagtatgaggattataaagctgaggattgcggcgaatatgcgacggatgagttggcggc |
200 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36569534 |
ttggttggtcggaggatgatccaaataaggaagattacgaagagtatgaggattataaagctgaggattgcggcaaatatgcgacggatgagttggcggc |
36569633 |
T |
 |
| Q |
201 |
gttcgtctccgtggaagtcacattctttagtcatggtggtggaaattttatatgatgactttg |
263 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36569634 |
gttcatctccgtggaagtcacattctttagtcatggtggtggaaattttatatgatgactttg |
36569696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University