View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10382_high_16 (Length: 279)

Name: NF10382_high_16
Description: NF10382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10382_high_16
NF10382_high_16
[»] chr2 (1 HSPs)
chr2 (1-263)||(36569434-36569696)


Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 36569434 - 36569696
Alignment:
1 ggttatggtgttgggtgtaggggtggttgaggatggtgtttctccggtggaggagaggttgaaggcgaagacggttgcgtcttggaggatgaaacggggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36569434 ggttatggtgttgggtgtaggggtggttgaggatggtgtttctccggtggaggagaggttgaaggcgaagacggttgcgtcttggaggatgaaacggggt 36569533  T
101 ttggttggccggaggataatccaaataaggaagattacgaagagtatgaggattataaagctgaggattgcggcgaatatgcgacggatgagttggcggc 200  Q
    |||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
36569534 ttggttggtcggaggatgatccaaataaggaagattacgaagagtatgaggattataaagctgaggattgcggcaaatatgcgacggatgagttggcggc 36569633  T
201 gttcgtctccgtggaagtcacattctttagtcatggtggtggaaattttatatgatgactttg 263  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36569634 gttcatctccgtggaagtcacattctttagtcatggtggtggaaattttatatgatgactttg 36569696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University