View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10382_high_23 (Length: 240)
Name: NF10382_high_23
Description: NF10382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10382_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 24 - 229
Target Start/End: Complemental strand, 2733753 - 2733548
Alignment:
| Q |
24 |
aatcgcatttctcgtttcgaatttactgtttcgtgattttgattaattctttcttgtttcaggtgatgacagtactactggaattaaaaagaaggttgag |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2733753 |
aatcgcatttctcgtttcgaatttactgtttcgtgtttttgattaattctttcttgtttcaggtgatgacagtactactggaattaaaaagaaggttgag |
2733654 |
T |
|
| Q |
124 |
gatgtagttccaattgctactggtcatgagcgtgaggagattcaggctcaacttgaggtctcttcattctatctatcttagcgataattcttttcattcc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2733653 |
gatgtagttccaattgctactggtcatgagcgtgaggagattcaggctcaacttgaggtctcttcattctatctatcttagctataattcttttcattcc |
2733554 |
T |
|
| Q |
224 |
attcat |
229 |
Q |
| |
|
|||||| |
|
|
| T |
2733553 |
attcat |
2733548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 112 - 182
Target Start/End: Original strand, 44414483 - 44414553
Alignment:
| Q |
112 |
aagaaggttgaggatgtagttccaattgctactggtcatgagcgtgaggagattcaggctcaacttgaggt |
182 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||| |||||||||||||| ||| | |||||||| |
|
|
| T |
44414483 |
aagacggttgaggatgtagttccaattgctaccggtcatgaacgtgaggagattcaagctgatcttgaggt |
44414553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 118 - 167
Target Start/End: Original strand, 19932765 - 19932814
Alignment:
| Q |
118 |
gttgaggatgtagttccaattgctactggtcatgagcgtgaggagattca |
167 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||| ||||||| |
|
|
| T |
19932765 |
gttgaggatgtagttacaattgctactggtcatgaacgtgagaagattca |
19932814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 167
Target Start/End: Original strand, 19922945 - 19922990
Alignment:
| Q |
122 |
aggatgtagttccaattgctactggtcatgagcgtgaggagattca |
167 |
Q |
| |
|
||||||||||| |||||||||| |||||||| |||||| ||||||| |
|
|
| T |
19922945 |
aggatgtagttacaattgctaccggtcatgaacgtgagaagattca |
19922990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 167
Target Start/End: Original strand, 19925695 - 19925740
Alignment:
| Q |
122 |
aggatgtagttccaattgctactggtcatgagcgtgaggagattca |
167 |
Q |
| |
|
||||||||||| |||||||||| |||||||| |||||| ||||||| |
|
|
| T |
19925695 |
aggatgtagttacaattgctaccggtcatgaacgtgagaagattca |
19925740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University