View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10382_high_28 (Length: 227)

Name: NF10382_high_28
Description: NF10382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10382_high_28
NF10382_high_28
[»] chr7 (2 HSPs)
chr7 (1-77)||(44492597-44492673)
chr7 (145-208)||(44492741-44492811)


Alignment Details
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 44492597 - 44492673
Alignment:
1 ttataagtacatagtttttataaaccgattttgtatagttgaattagacacgtacactgagtagttcagggggatcc 77  Q
    ||||||||| |||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||||||    
44492597 ttataagtagatagtttttataaatcgattttgtatagttgaattaaacacgtacattgagtagttcagggggatcc 44492673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 208
Target Start/End: Original strand, 44492741 - 44492811
Alignment:
145 taacatgaaaaattgaatctaaatttggttactt-------gggttccccaacctctaagttgctttgtta 208  Q
    |||||||||||||| |||||||||||||||||||       ||||||||||||||||||||||||||||||    
44492741 taacatgaaaaattaaatctaaatttggttacttgggacttgggttccccaacctctaagttgctttgtta 44492811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University