View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10382_high_28 (Length: 227)
Name: NF10382_high_28
Description: NF10382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10382_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 44492597 - 44492673
Alignment:
| Q |
1 |
ttataagtacatagtttttataaaccgattttgtatagttgaattagacacgtacactgagtagttcagggggatcc |
77 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
44492597 |
ttataagtagatagtttttataaatcgattttgtatagttgaattaaacacgtacattgagtagttcagggggatcc |
44492673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 145 - 208
Target Start/End: Original strand, 44492741 - 44492811
Alignment:
| Q |
145 |
taacatgaaaaattgaatctaaatttggttactt-------gggttccccaacctctaagttgctttgtta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44492741 |
taacatgaaaaattaaatctaaatttggttacttgggacttgggttccccaacctctaagttgctttgtta |
44492811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University