View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10382_low_24 (Length: 249)
Name: NF10382_low_24
Description: NF10382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10382_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 125 - 242
Target Start/End: Original strand, 46279392 - 46279509
Alignment:
| Q |
125 |
gcatggctaatttgaacttacttgttgaaggttattgagagaattgaacatcataggtggactccatttgctcataatgaacaaagaattatcttcatct |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279392 |
gcatggctaatttgaacttacttgttgaaggttattgagagaattgaacatcataggtggactccatttgctcataatgaacaaagaattatcttcatct |
46279491 |
T |
 |
| Q |
225 |
gaatgttgttcctttgct |
242 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46279492 |
gaatgttgttcctttgct |
46279509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 46279268 - 46279336
Alignment:
| Q |
1 |
atgcttcccaaggtttttccatggattggtgaaattgttcaaattgatgctgcaaacaatttcatgatt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279268 |
atgcttcccaaggtttttccatggattggtgaaattgttcaaattgatgctgcaaacaatttcatgatt |
46279336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University