View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10382_low_29 (Length: 239)

Name: NF10382_low_29
Description: NF10382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10382_low_29
NF10382_low_29
[»] chr3 (1 HSPs)
chr3 (1-222)||(40106383-40106607)


Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 40106383 - 40106607
Alignment:
1 cctgcaagctcgggtaagatatacttttgggcaatcttacccaagtttgaaaatgataaaagcaaattaactctcaagaaaacaacaatccaatcataaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40106383 cctgcaagctcgggtaagatatacttttgggcaatcttacccaagtttgaaaatgataaaagcaaattaactctcaagaaaacaacaatccaatcataaa 40106482  T
101 attctacaagatgtgataaccagttatgcataaaagatagc---nnnnnnnntgtataaataaaataatataattaacagcggagattcacccttctaaa 197  Q
    |||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||||||||||||||||||||||||||||||    
40106483 attctacaagatgtgataaccagttatgcataaaagatagcaaaaaaaaaaatgtataaataaaataatataattaacagcggagattcacccttctaaa 40106582  T
198 tctgtaatgaaaccctccaccccgc 222  Q
    |||||||||||||||||||||||||    
40106583 tctgtaatgaaaccctccaccccgc 40106607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University