View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10382_low_32 (Length: 230)
Name: NF10382_low_32
Description: NF10382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10382_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 937359 - 937158
Alignment:
| Q |
18 |
tatacctcggttgaacctttgaacctgtctcctgtttcgcatacctagtcttcaaattactctcaccatcaagattaatagtttgcacatatgcaacacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
937359 |
tatacctcggttgaacctttgaacctgtctcctgtttcgcatacctagtcttcaaattactctcaccatcaagattaatagtttgcacatatgcaacacc |
937260 |
T |
|
| Q |
118 |
agttggatcactagttgataacaaaacaatatcacaaggaattgtttcattcgttttgatttttacaatctcaccaacacgaatatccttccatttcttc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
937259 |
agttggatcactagttgataacaaaacaatatcacaaggaattgtttcatttgttttgatttttacaatctcaccaacacgaatatccttccatttcttc |
937160 |
T |
|
| Q |
218 |
tc |
219 |
Q |
| |
|
|| |
|
|
| T |
937159 |
tc |
937158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 44 - 219
Target Start/End: Complemental strand, 16941811 - 16941636
Alignment:
| Q |
44 |
gtctcctgtttcgcatacctagtcttcaaattactctcaccatcaagattaatagtttgcacatatgcaacaccagttggatcactagttgataacaaaa |
143 |
Q |
| |
|
||||| ||||| ||||| ||||||||||||||| ||||||||| ||||||| |||||| || || ||||||||||| |||||||| || || ||||||| |
|
|
| T |
16941811 |
gtctcttgttttgcatatctagtcttcaaattagactcaccatctagattaagagtttgaacgtaagcaacaccagtaggatcactcgtcgacaacaaaa |
16941712 |
T |
|
| Q |
144 |
caatatcacaaggaattgtttcattcgttttgatttttacaatctcaccaacacgaatatccttccatttcttctc |
219 |
Q |
| |
|
||| |||||||||||| | |||||| | |||||||| | ||||||||||| | |||||| |||||||||||||| |
|
|
| T |
16941711 |
caaaatcacaaggaatcggttcatttgcattgattttaatgatctcaccaactctaatatctttccatttcttctc |
16941636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University