View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10383_low_7 (Length: 291)
Name: NF10383_low_7
Description: NF10383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10383_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 32046430 - 32046642
Alignment:
| Q |
1 |
aagaaacattattggttccttctgaacaaatttggtggctgcaattgatgatgagtcttgcgagattcacaagggtgatagactgatggtcatttagtgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32046430 |
aagaaacattattggttccttctgaacaaatttggtggctgcaattgatgatgagtcttgcgagattcacaagggtgatagactgatggtcatttagtgc |
32046529 |
T |
|
| Q |
101 |
caaacaaaccatgggtggttgtacatggtgtattgtggaggaggaatacaagttcctaatgaggtaaaggatgagg-nnnnnnngccagattgctatagt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32046530 |
caaacaaaccatgggtggttgtacatggtgtactgtggaggaggaatacaagttcctaatgaggtaaaggatgaggaaaaaaaagccagattgctatagt |
32046629 |
T |
|
| Q |
200 |
gaatctacttatg |
212 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32046630 |
gaatctacttatg |
32046642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University