View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10384_low_1 (Length: 289)
Name: NF10384_low_1
Description: NF10384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10384_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 87
Target Start/End: Original strand, 17751340 - 17751409
Alignment:
| Q |
18 |
gaatttgtgtgtgtgtttcttttttcaagggctactttcagacctcgctacaattacaaggttatttgac |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17751340 |
gaatttgtgtgtgtgtttcttttttcaagggctactttcagacctcgctacaattacaaggttatttgac |
17751409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 87
Target Start/End: Original strand, 17760327 - 17760396
Alignment:
| Q |
18 |
gaatttgtgtgtgtgtttcttttttcaagggctactttcagacctcgctacaattacaaggttatttgac |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17760327 |
gaatttgtgtgtgtgtttcttttttcaagggctactttcagacctcgctacaattacaaggttatttgac |
17760396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 113 - 243
Target Start/End: Original strand, 17736131 - 17736257
Alignment:
| Q |
113 |
ttgaaaatattgtgtattgtagtgactaaaataccgttgctcttgttggttgggaaagaaataggtttagttgtatgttgtatttatttatgtaaggttt |
212 |
Q |
| |
|
||||||| |||||||||| ||||||| |||||||| || ||| ||||||| ||||||||||||||||| |||||||||| || |||||| | ||| |
|
|
| T |
17736131 |
ttgaaaacattgtgtattttagtgaccaaaataccctttatctagttggtttggaaagaaataggtttaattgtatgttg----tagttatgtcaaattt |
17736226 |
T |
 |
| Q |
213 |
aaagggttttaccgaggtttatattgcggtt |
243 |
Q |
| |
|
| ||||||||| |||||||||||||| |||| |
|
|
| T |
17736227 |
acagggttttatcgaggtttatattgtggtt |
17736257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 121 - 194
Target Start/End: Original strand, 15732797 - 15732870
Alignment:
| Q |
121 |
attgtgtattgtagtgactaaaataccgttgctcttgttggttgggaaagaaataggtttagttgtatgttgta |
194 |
Q |
| |
|
|||||||||| ||||||| |||||||| || || | ||||||| | |||||| |||||||| |||||||||||| |
|
|
| T |
15732797 |
attgtgtattttagtgaccaaaataccctttctgtagttggtttgaaaagaattaggtttaattgtatgttgta |
15732870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University