View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10385_high_10 (Length: 386)
Name: NF10385_high_10
Description: NF10385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10385_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 85 - 375
Target Start/End: Complemental strand, 2404285 - 2403995
Alignment:
| Q |
85 |
accatcttctaatttcttattgttctaacctcccatgttctacaccataaaaattctttcccatgttctaagttccataaccaagatgatcaatgacaac |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2404285 |
accatcttctaatttcttattgttctaacctcccatgttctacaccataaaaattcttttccatgttctaagttccataaccaagatgatcaatgacaac |
2404186 |
T |
|
| Q |
185 |
accccattctttgaactctatctcttaaaattccattgtacaaagcaactctatttgctggcattgcttttgtttctggaatttcatttctgcattcatt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2404185 |
accccattctttgaactctatctcttaaaattccattgtacaaagcaactctatttgctggcattgcttttgtttctggaatttcatttctgcattcatt |
2404086 |
T |
|
| Q |
285 |
aattgatactctgtttttcttccccggtttttctctaaattccttcaccatcacattttctgaaaatttcactttcttcttgttccttctt |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2404085 |
aattgatactctgtttttcttccccggtttttctctaaattcctttaccatcacattttctgaaaatttcactttcttcttgttccttctt |
2403995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 2404371 - 2404330
Alignment:
| Q |
1 |
gatcaattaggacttcaaatattgtttccaacgcacccacct |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2404371 |
gatcaattaggacttcaaatattgtttccaacgcacccacct |
2404330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University