View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10385_high_18 (Length: 251)
Name: NF10385_high_18
Description: NF10385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10385_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 45581493 - 45581728
Alignment:
| Q |
1 |
atgctctcgtctctcactctctgcatgcatactgttccaaacttttcctctcattttctccaaattttgatgcccattatctctttgcaaatccttgaga |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45581493 |
atgctctcgtctctcactctctgca----tactgttccaaacttttcctctccttttctccaaattttgatgcccattatctctttgcaaatccttcaga |
45581588 |
T |
 |
| Q |
101 |
atcatcaactaagttacgtctgtaattagagatgaacattatttcttcttcattttatgatttcgataatcactcaactttatagataaaggttttctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45581589 |
atcatcaactaagttacgtctgtaattagagatgaacattatttcttcttcattttatgatttcaataatcactcaactttatagataaaggttttctct |
45581688 |
T |
 |
| Q |
201 |
acctataatttataatctattcataatggttgctcttcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45581689 |
acctataatttataatctattcataatggttgctcttcat |
45581728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 77 - 246
Target Start/End: Original strand, 32551704 - 32551874
Alignment:
| Q |
77 |
ttatctctttgcaaatccttgagaatcatcaactaagttacgtctgtaattagagatgaacattatttcttcttcattttatgatttcgataatcactca |
176 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| ||| | ||||||||||||| | |||||||||||| |||||||||| ||||||| ||||||| |
|
|
| T |
32551704 |
ttatctctttgcaattccttttgaatcatcaactaaattatttttgtaattagagatcatcattatttcttcctcattttatggtttcgatggtcactca |
32551803 |
T |
 |
| Q |
177 |
actttatagataaaggttttctctac--ctataatttataatctattcataatggttgctcttcatctcact |
246 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||| ||||||||||| | ||||||||||| ||||| |
|
|
| T |
32551804 |
actttatagataaagtttttctctacctctataatttatattctattcataa-gtttgctcttcatttcact |
32551874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University