View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10385_high_7 (Length: 418)
Name: NF10385_high_7
Description: NF10385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10385_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 23 - 362
Target Start/End: Original strand, 45414915 - 45415254
Alignment:
| Q |
23 |
cggccttcactacgtccaatcaaggctcgaatcccttcacgagcttgagagtctccttctcggtgcccccgtcgattatcttcgcgcctacgtctccgac |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45414915 |
cggccttcactacgtccaatcaaggctcgaatcccttcacgagcttgagagtctccttctcggtgcccccgtcgattatcttcgtgcctacgtctccgac |
45415014 |
T |
|
| Q |
123 |
ctcggtgatcaccgtgcactcgagcaactccgtaggatccttcgtcttctcacttccctcaaggttgtttctgtcttgcaacctccagttagggatccca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45415015 |
ctcggtgatcaccgtgcactcgagcaactccgtaggatccttcgtcttctcacttccctcaaggttgtttctgtcttgcaacctccagttagggatccca |
45415114 |
T |
|
| Q |
223 |
ctccattgtctttcttgccttttgggaggttgaaggttcttgagctcagaggttgcgacctctctacttccgccgccaaaggtttgctcgacctcaggca |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45415115 |
ctccattgtctttcttgccttttgggaggttgaaggttcttgagctcagaggttgcgacctctctacttccgccgccaaaggtttgctcgacctcaggca |
45415214 |
T |
|
| Q |
323 |
tactctcgagaagattatttgtcacaattctactgtaagt |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45415215 |
tactctcgagaagattatttgtcacaattctactgtaagt |
45415254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University