View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10385_low_15 (Length: 335)
Name: NF10385_low_15
Description: NF10385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10385_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 53 - 318
Target Start/End: Complemental strand, 41249262 - 41248999
Alignment:
| Q |
53 |
tggtaattattcggtaaaaatgtcatatcttttttgtgcttaggctcgaggagataaacatataagaagtcgaagaagccaagcaaagatattggaaacc |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41249262 |
tggtaattattcggtaaaaatgtcatatcttttttgtgcttaggctcgaggagataaacata--agaagtcgaagaagccaagcaaagatattggaaacc |
41249165 |
T |
 |
| Q |
153 |
atagctacaattttaggtgctatagtaatattgtttgtcaaaggctcggttatttttgggacggttggaggtagccacaacaagcatggtgctgcacata |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41249164 |
atagctacaattttaggtgctatagtaatattgtttgtcaaaggctcggttatttttgggacggttggaggtagccacaacaagcatggtgctgcacata |
41249065 |
T |
 |
| Q |
253 |
tgatagttggatctatctttataacattataatgttttgtttcagttggacttgttctgtgctcct |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
41249064 |
tgatagttggatctatctttataacattataatgttttgtttcagttggacttgttttgtgatcct |
41248999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University